| siRNA Id: | virsi1187 |
| Sense Sequence: | aaacguaacaccaaccgucgc |
| Length: | 21 |
| GC Content (%): | 52 |
| Virus Name: | Hepatitis C Virus [HCV] |
| Family of Virus: | Flaviviridae |
| Virus Strain: | Genotype 2a |
| Target Gene: | 5'UTR |
| Starting Position | 375 |
| Ending Position: | 395 |
| Cell Line: | Huh-7 |
| Transfection Method: | Lipofectamine |
| Incubation Time (Hours): | 72 |
| siRNA Expression Method: | Chemically Synthesized |
| PubMed: | 17079316 |
| Target Object (mRNA,Protein,etc): | RNA |
| Silencing Efficacy : | 27 |
| Structure: |  |
| siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: |  |
| RNA % inhibition: | 26.9 |
| RNA Detection method: | Luciferase Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.