virsi1218 details

siRNA Id:virsi1218
Sense Sequence: ggagaugaaggcgaaggcguc
Length: 21
GC Content (%):62
Virus Name:Hepatitis C Virus [HCV]
Family of Virus:Flaviviridae
Virus Strain:Genotype 1b
Target Gene:NS5B(S)
Cell Line: Huh-7
Incubation Time (Hours): 48
siRNA Expression Method: Expressed
siRNA design algorithm used: Ui-Tei/Reynolds/Amarzguioui
PubMed:17305886
Target Object (mRNA,Protein,etc): Protein
Silencing Efficacy :90
Structure:
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome:
Protein1:Luciferase
Protein1 % inhibition:90.1
Protein1 Detection Method:Luciferase Assay

.
.
.
.
.
.
.
.
.
.
.

.

.

.