| siRNA Id: | virsi1218 |
| Sense Sequence: | ggagaugaaggcgaaggcguc |
| Length: | 21 |
| GC Content (%): | 62 |
| Virus Name: | Hepatitis C Virus [HCV] |
| Family of Virus: | Flaviviridae |
| Virus Strain: | Genotype 1b |
| Target Gene: | NS5B(S) |
| Cell Line: | Huh-7 |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Expressed |
| siRNA design algorithm used: | Ui-Tei/Reynolds/Amarzguioui |
| PubMed: | 17305886 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 90 |
| Structure: | ![]() |
| siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | ![]() |
| Protein1: | Luciferase |
| Protein1 % inhibition: | 90.1 |
| Protein1 Detection Method: | Luciferase Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.

