siRNA Id: | virsi1220 |
Sense Sequence: | gacacugagacaccaauugac |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | Hepatitis C Virus [HCV] |
Family of Virus: | Flaviviridae |
Virus Strain: | Genotype 1b |
Target Gene: | NS5B(S) |
Cell Line: | Huh-7 |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Expressed |
siRNA design algorithm used: | Ui-Tei/Reynolds/Amarzguioui |
PubMed: | 17305886 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 69 |
Structure: | |
siRNA sequence matching with Hepatitis C Virus [HCV] reference genome: | |
Protein1: | Luciferase |
Protein1 % inhibition: | 69 |
Protein1 Detection Method: | Luciferase Assay |
.
.
.
.
.
.
.
.
.
.
.
.
.