| siRNA Id: | virsi1295 |
| Sense Sequence: | aaggaguuccugaucuucuggu |
| Length: | 22 |
| GC Content (%): | 45 |
| Virus Name: | SARS Coronavirus |
| Family of Virus: | Coronaviridae |
| Virus Strain: | TW-PH2_SC27 Isolate |
| Target Gene: | Env |
| Genbank Accession: | AY451891 |
| Starting Position | 269 |
| Ending Position: | 290 |
| Cell Line: | NIH 3T3 |
| Transfection Method: | FuGENE |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Expressed |
| siRNA design algorithm used: | Ambion |
| PubMed: | 16757801 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 97 |
| Structure: |  |
| siRNA sequence matching with SARS Coronavirus reference genome: |  |
| Target mRNA1: | Envelope |
| mRNA1 % inhibition: | 97 |
| mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.