siRNA Id: | virsi1297 |
Sense Sequence: | aaauaccacgucgcaauguggc |
Length: | 22 |
GC Content (%): | 50 |
Virus Name: | SARS Coronavirus |
Family of Virus: | Coronaviridae |
Virus Strain: | TW-PH2_SC27 Isolate |
Target Gene: | RdRp |
Genbank Accession: | AY268070 |
Starting Position | 222 |
Ending Position: | 243 |
Cell Line: | NIH 3T3 |
Transfection Method: | FuGENE |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Expressed |
siRNA design algorithm used: | Ambion |
PubMed: | 16757801 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 60 |
Structure: | ![]() |
siRNA sequence matching with SARS Coronavirus reference genome: | ![]() |
Target mRNA1: | RdRp |
mRNA1 % inhibition: | 60 |
mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.