virsi1300 details

siRNA Id:virsi1300
Sense Sequence: aaaccaacgguuuacgucuac
Length: 21
GC Content (%):43
Virus Name:SARS Coronavirus
Family of Virus:Coronaviridae
Virus Strain:TW-PH2_SC27 Isolate
Target Gene:Env
Genbank Accession: AY451891
Starting Position 220
Ending Position: 240
Cell Line: NIH 3T3
Transfection Method: FuGENE
Incubation Time (Hours): 48
siRNA Expression Method: Expressed
siRNA design algorithm used: Ambion
PubMed:16757801
Target Object (mRNA,Protein,etc): mRNA
Silencing Efficacy :89
Structure:
siRNA sequence matching with SARS Coronavirus reference genome:
Target mRNA1:Envelope
mRNA1 % inhibition:89
mRNA1 Detection Method:RT-PCR

.
.
.
.
.
.
.
.
.
.
.

.

.

.