| siRNA Id: | virsi1337 |
| Sense Sequence: | caagccucuucucgcuccuc |
| Length: | 20 |
| GC Content (%): | 60 |
| Virus Name: | SARS Coronavirus |
| Family of Virus: | Coronaviridae |
| Virus Strain: | GZ50 |
| Target Gene: | N |
| Genbank Accession: | AY304495 |
| Starting Position | 28648 |
| Ending Position: | 28667 |
| Cell Line: | FRhK-4 |
| Concentration: | 200nM |
| Transfection Method: | Oligofectamine |
| Incubation Time (Hours): | 24 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Sontheimer/Chen Y |
| PubMed: | 16638566 |
| Target Object (mRNA,Protein,etc): | RNA |
| Silencing Efficacy : | 67 |
| Structure: |  |
| siRNA sequence matching with SARS Coronavirus reference genome: |  |
| RNA % inhibition: | 67 |
| RNA Detection method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.