siRNA Id: | virsi1339 |
Sense Sequence: | cacugauuccguucgagauc |
Length: | 20 |
GC Content (%): | 50 |
Virus Name: | SARS Coronavirus |
Family of Virus: | Coronaviridae |
Virus Strain: | GZ50 |
Target Gene: | Spike |
Genbank Accession: | AY304495 |
Starting Position | 23150 |
Ending Position: | 23169 |
Cell Line: | FRhK-4 |
Concentration: | 200nM |
Transfection Method: | Oligofectamine |
Incubation Time (Hours): | 24 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Sontheimer/Chen Y |
PubMed: | 16638566 |
Target Object (mRNA,Protein,etc): | RNA |
Silencing Efficacy : | 83 |
Structure: | ![]() |
siRNA sequence matching with SARS Coronavirus reference genome: | ![]() |
RNA % inhibition: | 83.3 |
RNA Detection method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.