virsi1370 details

siRNA Id:virsi1370
Sense Sequence: gucacucaagcauuugggaga
Length: 21
GC Content (%):48
Virus Name:SARS Coronavirus
Family of Virus:Coronaviridae
Virus Strain:CUHK-W1
Target Gene:N
Genbank Accession: AY278554
Starting Position 28915
Ending Position: 28935
Cell Line: 293T
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 48
siRNA Expression Method: Expressed
siRNA design algorithm used: Rule Based
PubMed:15848179
Target Object (mRNA,Protein,etc): mRNA
Silencing Efficacy :48
Structure:
siRNA sequence matching with SARS Coronavirus reference genome:
Target mRNA1:Nucleocapsid
mRNA1 % inhibition:48
mRNA1 Detection Method:RT-PCR

.
.
.
.
.
.
.
.
.
.
.

.

.

.