siRNA Id: | virsi1370 |
Sense Sequence: | gucacucaagcauuugggaga |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | SARS Coronavirus |
Family of Virus: | Coronaviridae |
Virus Strain: | CUHK-W1 |
Target Gene: | N |
Genbank Accession: | AY278554 |
Starting Position | 28915 |
Ending Position: | 28935 |
Cell Line: | 293T |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Expressed |
siRNA design algorithm used: | Rule Based |
PubMed: | 15848179 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 48 |
Structure: | ![]() |
siRNA sequence matching with SARS Coronavirus reference genome: | ![]() |
Target mRNA1: | Nucleocapsid |
mRNA1 % inhibition: | 48 |
mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.