virsi1381 details

siRNA Id:virsi1381
Sense Sequence: aaggccaaaacagcgccgacc
Length: 21
GC Content (%):62
Virus Name:SARS Coronavirus
Family of Virus:Coronaviridae
Target Gene:N
Genbank Accession: NC_004734
Starting Position 28227
Ending Position: 28247
Cell Line: Vero E6
Concentration: 30nM
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 48
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: Elbashir
PubMed:15780182
Target Object (mRNA,Protein,etc): mRNA
Silencing Efficacy :29
Structure:
siRNA sequence matching with SARS Coronavirus reference genome:
Target mRNA1:Nucleocapsid
mRNA1 % inhibition:29
mRNA1 Detection Method:RT-PCR

.
.
.
.
.
.
.
.
.
.
.

.

.

.