siRNA Id: | virsi1381 |
Sense Sequence: | aaggccaaaacagcgccgacc |
Length: | 21 |
GC Content (%): | 62 |
Virus Name: | SARS Coronavirus |
Family of Virus: | Coronaviridae |
Target Gene: | N |
Genbank Accession: | NC_004734 |
Starting Position | 28227 |
Ending Position: | 28247 |
Cell Line: | Vero E6 |
Concentration: | 30nM |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Elbashir |
PubMed: | 15780182 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 29 |
Structure: | |
siRNA sequence matching with SARS Coronavirus reference genome: | |
Target mRNA1: | Nucleocapsid |
mRNA1 % inhibition: | 29 |
mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.