| siRNA Id: | virsi1381 |
| Sense Sequence: | aaggccaaaacagcgccgacc |
| Length: | 21 |
| GC Content (%): | 62 |
| Virus Name: | SARS Coronavirus |
| Family of Virus: | Coronaviridae |
| Target Gene: | N |
| Genbank Accession: | NC_004734 |
| Starting Position | 28227 |
| Ending Position: | 28247 |
| Cell Line: | Vero E6 |
| Concentration: | 30nM |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Elbashir |
| PubMed: | 15780182 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 29 |
| Structure: | ![]() |
| siRNA sequence matching with SARS Coronavirus reference genome: | ![]() |
| Target mRNA1: | Nucleocapsid |
| mRNA1 % inhibition: | 29 |
| mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.

