siRNA Id: | virsi1418 |
Sense Sequence: | aacuugccgcacaucaaacc |
Length: | 20 |
GC Content (%): | 50 |
Virus Name: | La Crosse Virus |
Family of Virus: | Bunyaviridae |
Target Gene: | M (G2) |
Genbank Accession: | NC_004110 |
Cell Line: | 293T |
Concentration: | 100 nM |
Transfection Method: | siPORT |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Dhamacon |
PubMed: | 15596819 |
Target Object (mRNA,Protein,etc): | Viral Titer |
Silencing Efficacy : | High |
Structure: | ![]() |
siRNA sequence matching with La Crosse Virus reference genome: | ![]() |
.
.
.
.
.
.
.
.
.
.
.
.
.