virsi1418 details

siRNA Id:virsi1418
Sense Sequence: aacuugccgcacaucaaacc
Length: 20
GC Content (%):50
Virus Name:La Crosse Virus
Family of Virus:Bunyaviridae
Target Gene:M (G2)
Genbank Accession: NC_004110
Cell Line: 293T
Concentration: 100 nM
Transfection Method: siPORT
Incubation Time (Hours): 48
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: Dhamacon
PubMed:15596819
Target Object (mRNA,Protein,etc): Viral Titer
Silencing Efficacy :High
Structure:
siRNA sequence matching with La Crosse Virus reference genome:

.
.
.
.
.
.
.
.
.
.
.

.

.

.