| siRNA Id: | virsi1421 |
| Sense Sequence: | agaugauauugcgggugcuu |
| Length: | 20 |
| GC Content (%): | 45 |
| Virus Name: | La Crosse Virus |
| Family of Virus: | Bunyaviridae |
| Target Gene: | M (G2) |
| Genbank Accession: | NC_004110 |
| Cell Line: | 293T |
| Concentration: | 100 nM |
| Transfection Method: | siPORT |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Dhamacon |
| PubMed: | 15596819 |
| Target Object (mRNA,Protein,etc): | Viral Titer |
| Silencing Efficacy : | High |
| Structure: |  |
| siRNA sequence matching with La Crosse Virus reference genome: |  |
.
.
.
.
.
.
.
.
.
.
.
.
.