| siRNA Id: | virsi1442 |
| Sense Sequence: | cgaccgaccuugaggcauacu |
| Length: | 21 |
| GC Content (%): | 57 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Virus Strain: | ayw |
| Target Gene: | X |
| Genbank Accession: | U95551 |
| Starting Position | 1689 |
| Ending Position: | 1709 |
| Cell Line: | HepG2.2.15 |
| Transfection Method: | Oligofectamine |
| Incubation Time (Hours): | 120 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Elbashir |
| PubMed: | 17245534 |
| Target Object (mRNA,Protein,etc): | Viral Load |
| Silencing Efficacy : | 72 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Virus Load % inhibition: | 72 |
| Virus Load Method: | Real-Time RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.