siRNA Id: | virsi1445 |
Sense Sequence: | ccuagaagaagaacucccucgccuc |
Length: | 25 |
GC Content (%): | 56 |
Virus Name: | Hepatitis B Virus [HBV] |
Family of Virus: | Hepadnaviridae |
Target Gene: | P |
Cell Line: | 293T |
Incubation Time (Hours): | 168 |
siRNA Expression Method: | Expressed |
PubMed: | 19804649 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 68 |
Structure: | ![]() |
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | ![]() |
Virus Load % inhibition: | 50 |
Virus Load Method: | FQ-PCR |
Target mRNA1: | S-mRNA |
mRNA1 % inhibition: | 82 |
mRNA1 Detection Method: | Real-Time PCR |
Target mRNA2: | C-mRNA |
mRNA2 % inhibition : | 80 |
mRNA2 Detection Method: | Real-Time PCR |
Protein1: | HBsAg |
Protein1 % inhibition: | 68 |
Protein1 Detection Method: | ELISA |
Protein2: | HBeAg |
Protein2 % inhibition : | 44 |
Protein2 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.