| siRNA Id: | virsi1446 |
| Sense Sequence: | cucaguuuacuagugccauuuguuc |
| Length: | 25 |
| GC Content (%): | 40 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Target Gene: | C |
| Cell Line: | 293T |
| Incubation Time (Hours): | 168 |
| siRNA Expression Method: | Expressed |
| PubMed: | 19804649 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 90 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Virus Load % inhibition: | 68 |
| Virus Load Method: | FQ-PCR |
| Target mRNA1: | S-mRNA |
| mRNA1 % inhibition: | 93 |
| mRNA1 Detection Method: | Real-Time PCR |
| Target mRNA2: | C-mRNA |
| mRNA2 % inhibition : | 96 |
| mRNA2 Detection Method: | Real-Time PCR |
| Protein1: | HBsAg |
| Protein1 % inhibition: | 90 |
| Protein1 Detection Method: | ELISA |
| Protein2: | HBeAg |
| Protein2 % inhibition : | 68.5 |
| Protein2 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.