| siRNA Id: | virsi1450 |
| Sense Sequence: | gggaccaugcagaaccugcacgauu |
| Length: | 25 |
| GC Content (%): | 56 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Target Gene: | S |
| Starting Position | 508 |
| Ending Position: | 532 |
| Cell Line: | HepG2.2.15 |
| Transfection Method: | Lipofectamine 2000 |
| siRNA Expression Method: | Expressed |
| PubMed: | 17588164 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 54 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Protein1: | HBsAg |
| Protein1 % inhibition: | 54.4 |
| Protein1 Detection Method: | ELISA |
| Protein2: | HBeAg |
| Protein2 % inhibition : | 10 |
| Protein2 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.