siRNA Id: | virsi1452 |
Sense Sequence: | ggcuggcauucuauauaagagagaa |
Length: | 25 |
GC Content (%): | 40 |
Virus Name: | Hepatitis B Virus [HBV] |
Family of Virus: | Hepadnaviridae |
Target Gene: | P |
Starting Position | 2765 |
Ending Position: | 2789 |
Cell Line: | HepG2.2.15 |
Transfection Method: | Lipofectamine 2000 |
siRNA Expression Method: | Expressed |
PubMed: | 17588164 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 54 |
Structure: | ![]() |
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | ![]() |
Protein1: | HBsAg |
Protein1 % inhibition: | 54 |
Protein1 Detection Method: | ELISA |
Protein2: | HBeAg |
Protein2 % inhibition : | 37 |
Protein2 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.