| siRNA Id: | virsi1454 |
| Sense Sequence: | aagucuguacagcaucuugag |
| Length: | 21 |
| GC Content (%): | 43 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Target Gene: | ORF |
| Genbank Accession: | EF103275 |
| Cell Line: | HepG2.2.15 |
| Transfection Method: | Lipofectamine |
| Incubation Time (Hours): | 168 |
| siRNA Expression Method: | Expressed |
| PubMed: | 18474581 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 70 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Virus Load % inhibition: | 60 |
| Virus Load Method: | Real-Time RT-PCR |
| RNA % inhibition: | 70 |
| RNA Detection method: | Real-Time RT-PCR |
| Protein1: | HBsAg |
| Protein1 % inhibition: | 70 |
| Protein1 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.