siRNA Id: | virsi1455 |
Sense Sequence: | ggacauugacccguauaaagac |
Length: | 22 |
GC Content (%): | 45 |
Virus Name: | Hepatitis B Virus [HBV] |
Family of Virus: | Hepadnaviridae |
Target Gene: | ORF |
Genbank Accession: | EF103275 |
Cell Line: | HepG2.2.15 |
Transfection Method: | Lipofectamine |
Incubation Time (Hours): | 168 |
siRNA Expression Method: | Expressed |
PubMed: | 18474581 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 55 |
Structure: | |
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | |
RNA Detection method: | Real-Time RT-PCR |
Protein1: | HBsAg |
Protein1 % inhibition: | 55 |
Protein1 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.