| siRNA Id: | virsi1456 |
| Sense Sequence: | gccuuagagucuccugagcu |
| Length: | 20 |
| GC Content (%): | 55 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Target Gene: | C |
| Cell Line: | HepG2 |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 72 |
| siRNA Expression Method: | Expressed |
| PubMed: | 16929350 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 36 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Protein1: | HBsAg |
| Protein1 % inhibition: | 0 |
| Protein1 Detection Method: | ELISA |
| Protein2: | HBeAg |
| Protein2 % inhibition : | 36 |
| Protein2 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.