| siRNA Id: | virsi1473 |
| Sense Sequence: | uccccgucugugccuucucaucugc |
| Length: | 25 |
| GC Content (%): | 60 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Target Gene: | X |
| Cell Line: | Huh-7 |
| Incubation Time (Hours): | 192 |
| siRNA Expression Method: | Chemically Synthesized |
| PubMed: | 12740585 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 70 |
| Structure: | ![]() |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | ![]() |
| Protein1: | HBsAg |
| Protein1 % inhibition: | 70 |
| Protein1 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.

