virsi1480 details

siRNA Id:virsi1480
Sense Sequence: gccgagaucgcacagagacuu
Length: 21
GC Content (%):57
Virus Name:Influenza A Virus
Family of Virus:Orthomyxoviridae
Virus Strain:H1N1
Target Gene:M
Genbank Accession: L25818
Starting Position 89
Ending Position: 109
Cell Line: 293T
Transfection Method: Lipofectamine
Incubation Time (Hours): 13
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: Elbashir
PubMed:15218172
Target Object (mRNA,Protein,etc): Protein
Silencing Efficacy :70
Structure:
siRNA sequence matching with Influenza A Virus reference genome:
Protein1:M1
Protein1 % inhibition:70
Protein1 Detection Method:Fluorescence-Activated Cell Sorter (FACS)

.
.
.
.
.
.
.
.
.
.
.

.

.

.