siRNA Id: | virsi1482 |
Sense Sequence: | gcagcagaggccauggauauu |
Length: | 21 |
GC Content (%): | 52 |
Virus Name: | Influenza A Virus |
Family of Virus: | Orthomyxoviridae |
Virus Strain: | H1N1 |
Target Gene: | M |
Genbank Accession: | L25818 |
Starting Position | 620 |
Ending Position: | 640 |
Cell Line: | 293T |
Transfection Method: | Lipofectamine |
Incubation Time (Hours): | 13 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Elbashir |
PubMed: | 15218172 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 52 |
Structure: | ![]() |
siRNA sequence matching with Influenza A Virus reference genome: | ![]() |
Protein1: | M1 |
Protein1 % inhibition: | 52 |
Protein1 Detection Method: | Fluorescence-Activated Cell Sorter (FACS) |
.
.
.
.
.
.
.
.
.
.
.
.
.