| siRNA Id: | virsi1496 |
| Sense Sequence: | gcuuaagagggagauaacauu |
| Length: | 21 |
| GC Content (%): | 38 |
| Virus Name: | Influenza A Virus |
| Family of Virus: | Orthomyxoviridae |
| Virus Strain: | H1N1 |
| Target Gene: | M |
| Genbank Accession: | L25818 |
| Starting Position | 331 |
| Ending Position: | 351 |
| Cell Line: | MDCK |
| Transfection Method: | Lipofectamine |
| Incubation Time (Hours): | 10 |
| siRNA Expression Method: | Expressed |
| siRNA design algorithm used: | Elbashir |
| PubMed: | 15218172 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | High |
| Structure: |  |
| siRNA sequence matching with Influenza A Virus reference genome: |  |
| Protein1: | M1 |
| Protein1 % inhibition: | High |
| Protein1 Detection Method: | Fuorescence microscope |
.
.
.
.
.
.
.
.
.
.
.
.
.