siRNA Id: | virsi1499 |
Sense Sequence: | gggagcauugacacaugugca |
Length: | 21 |
GC Content (%): | 52 |
Virus Name: | Japanese Encephalitis Virus [JE] |
Family of Virus: | Flaviviridae |
Target Gene: | E |
Genbank Accession: | 16464133 |
Starting Position | 1307 |
Ending Position: | 1328 |
Cell Line: | Monkey Kidney Cells |
Transfection Method: | Lipofectamine |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Dhamacon |
PubMed: | 16464133 |
Target Object (mRNA,Protein,etc): | Viral Load |
Silencing Efficacy : | 90 |
Structure: | ![]() |
siRNA sequence matching with Japanese Encephalitis Virus [JE] reference genome: | ![]() |
Virus Load % inhibition: | 90 |
Virus Load Method: | Virus Replication |
.
.
.
.
.
.
.
.
.
.
.
.
.