| siRNA Id: | virsi1499 |
| Sense Sequence: | gggagcauugacacaugugca |
| Length: | 21 |
| GC Content (%): | 52 |
| Virus Name: | Japanese Encephalitis Virus [JE] |
| Family of Virus: | Flaviviridae |
| Target Gene: | E |
| Genbank Accession: | 16464133 |
| Starting Position | 1307 |
| Ending Position: | 1328 |
| Cell Line: | Monkey Kidney Cells |
| Transfection Method: | Lipofectamine |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Dhamacon |
| PubMed: | 16464133 |
| Target Object (mRNA,Protein,etc): | Viral Load |
| Silencing Efficacy : | 90 |
| Structure: | ![]() |
| siRNA sequence matching with Japanese Encephalitis Virus [JE] reference genome: | ![]() |
| Virus Load % inhibition: | 90 |
| Virus Load Method: | Virus Replication |
.
.
.
.
.
.
.
.
.
.
.
.
.

