| siRNA Id: | virsi1500 |
| Sense Sequence: | gaagacauagauuguuggugca |
| Length: | 22 |
| GC Content (%): | 41 |
| Virus Name: | Dengue Virus [DENV] |
| Family of Virus: | Flaviviridae |
| Target Gene: | PreM |
| Genbank Accession: | NC_001474 |
| Cell Line: | HEK 293a |
| Transfection Method: | Calcium Phosohate |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Ambion |
| PubMed: | 15301687 |
| Target Object (mRNA,Protein,etc): | Cell Count |
| Silencing Efficacy : | 28 |
| Structure: |  |
| siRNA sequence matching with Dengue Virus [DENV] reference genome: |  |
.
.
.
.
.
.
.
.
.
.
.
.
.