siRNA Id: | virsi1665 |
Sense Sequence: | caggauccucaaccacccac |
Length: | 20 |
GC Content (%): | 60 |
Virus Name: | Hepatitis B Virus [HBV] |
Family of Virus: | Hepadnaviridae |
Virus Strain: | ayw |
Target Gene: | S |
Genbank Accession: | U95551 |
Starting Position | 488 |
Ending Position: | 507 |
Cell Line: | HeLa |
Concentration: | 1 μg |
Transfection Method: | Lipofectamine |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Chemically Synthesized |
PubMed: | 15387899 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 41 |
Structure: | |
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | |
Target mRNA1: | HBs |
mRNA1 % inhibition: | 56.8 |
mRNA1 Detection Method: | RT-PCR |
RNA % inhibition: | 66 |
RNA Detection method: | RT-PCR |
Protein1: | HBsAg |
Protein1 % inhibition: | 41.4 |
Protein1 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.