| siRNA Id: | virsi1665 |
| Sense Sequence: | caggauccucaaccacccac |
| Length: | 20 |
| GC Content (%): | 60 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Virus Strain: | ayw |
| Target Gene: | S |
| Genbank Accession: | U95551 |
| Starting Position | 488 |
| Ending Position: | 507 |
| Cell Line: | HeLa |
| Concentration: | 1 μg |
| Transfection Method: | Lipofectamine |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Chemically Synthesized |
| PubMed: | 15387899 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 41 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Target mRNA1: | HBs |
| mRNA1 % inhibition: | 56.8 |
| mRNA1 Detection Method: | RT-PCR |
| RNA % inhibition: | 66 |
| RNA Detection method: | RT-PCR |
| Protein1: | HBsAg |
| Protein1 % inhibition: | 41.4 |
| Protein1 Detection Method: | ELISA |
.
.
.
.
.
.
.
.
.
.
.
.
.