| siRNA Id: | virsi1666 |
| Sense Sequence: | aaugucaacaaccgaccuuga |
| Length: | 21 |
| GC Content (%): | 43 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Virus Strain: | adw |
| Target Gene: | X |
| Genbank Accession: | GQ855357 |
| Starting Position | 306 |
| Ending Position: | 326 |
| Cell Line: | Hep3B |
| Transfection Method: | Oligofectamine |
| Incubation Time (Hours): | 48 |
| siRNA design algorithm used: | Ambion |
| PubMed: | 17296261 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 98 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Target mRNA1: | HBx |
| mRNA1 % inhibition: | 98 |
| mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.