siRNA Id: | virsi1666 |
Sense Sequence: | aaugucaacaaccgaccuuga |
Length: | 21 |
GC Content (%): | 43 |
Virus Name: | Hepatitis B Virus [HBV] |
Family of Virus: | Hepadnaviridae |
Virus Strain: | adw |
Target Gene: | X |
Genbank Accession: | GQ855357 |
Starting Position | 306 |
Ending Position: | 326 |
Cell Line: | Hep3B |
Transfection Method: | Oligofectamine |
Incubation Time (Hours): | 48 |
siRNA design algorithm used: | Ambion |
PubMed: | 17296261 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 98 |
Structure: | ![]() |
siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: | ![]() |
Target mRNA1: | HBx |
mRNA1 % inhibition: | 98 |
mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.