| siRNA Id: | virsi1668 |
| Sense Sequence: | acgacagucaauugcagacaa |
| Length: | 21 |
| GC Content (%): | 43 |
| Virus Name: | Hepatitis B Virus [HBV] |
| Family of Virus: | Hepadnaviridae |
| Target Gene: | S |
| Genbank Accession: | M19183 |
| Starting Position | 632 |
| Ending Position: | 652 |
| Cell Line: | BHK/HepG2 |
| Concentration: | 150 pM |
| Transfection Method: | Lipofectamine |
| Incubation Time (Hours): | 72 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Hiperformance Design (Novartis) |
| PubMed: | 19064272 |
| Target Object (mRNA,Protein,etc): | RNA |
| Silencing Efficacy : | 65 |
| Structure: |  |
| siRNA sequence matching with Hepatitis B Virus [HBV] reference genome: |  |
| Target mRNA1: | S |
| mRNA1 % inhibition: | 65 |
| mRNA1 Detection Method: | Northern Blot |
.
.
.
.
.
.
.
.
.
.
.
.
.