siRNA Id: | virsi1677 |
Sense Sequence: | guucaccuagauagcccgaua |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | Measles Virus |
Family of Virus: | Paramyxoviridae |
Virus Strain: | Ichinose-B95a |
Target Gene: | L |
Genbank Accession: | AB016162 |
Starting Position | 9273 |
Ending Position: | 9293 |
Cell Line: | Vero/SLAM |
Concentration: | 20 nM |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Espec Oligo Service |
PubMed: | 16530274 |
Target Object (mRNA,Protein,etc): | Viral Titer |
Silencing Efficacy : | 90 |
Structure: | ![]() |
siRNA sequence matching with Measles Virus reference genome: | ![]() |
Protein1: | L |
Protein1 % inhibition: | 90.48 |
Protein1 Detection Method: | Virus Titer |
.
.
.
.
.
.
.
.
.
.
.
.
.