| siRNA Id: | virsi1680 |
| Sense Sequence: | guccaagcuuaggaguuaucc |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | Measles Virus |
| Family of Virus: | Paramyxoviridae |
| Virus Strain: | Ichinose-B95a |
| Target Gene: | L |
| Genbank Accession: | AB016162 |
| Starting Position | 9452 |
| Ending Position: | 9272 |
| Cell Line: | Vero/SLAM |
| Concentration: | 20 nM |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Espec Oligo Service |
| PubMed: | 16530274 |
| Target Object (mRNA,Protein,etc): | Viral Titer |
| Silencing Efficacy : | 76 |
| Structure: | ![]() |
| siRNA sequence matching with Measles Virus reference genome: | ![]() |
| Protein1: | L |
| Protein1 % inhibition: | 76.2 |
| Protein1 Detection Method: | Virus Titer |
.
.
.
.
.
.
.
.
.
.
.
.
.

