siRNA Id: | virsi1706 |
Sense Sequence: | ggucgauguaugucuuguugc |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | Human Papillomavirus [HPV] |
Family of Virus: | Papillomaviridae |
Virus Strain: | HPV16 |
Target Gene: | E6 / E7 |
Genbank Accession: | NC_001526 |
Starting Position | 503 |
Ending Position: | 523 |
Cell Line: | 147T |
Transfection Method: | Calcium Phosohate |
Incubation Time (Hours): | 24 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | BLOCK-iT Invitrogen |
PubMed: | 19276448 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | Low |
Structure: | |
siRNA sequence matching with Human Papillomavirus [HPV] reference genome: | |
Target mRNA1: | E6/E7 |
mRNA1 % inhibition: | Low |
mRNA1 Detection Method: | Quantitative RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.