virsi1706 details

siRNA Id:virsi1706
Sense Sequence: ggucgauguaugucuuguugc
Length: 21
GC Content (%):48
Virus Name:Human Papillomavirus [HPV]
Family of Virus:Papillomaviridae
Virus Strain:HPV16
Target Gene:E6 / E7
Genbank Accession: NC_001526
Starting Position 503
Ending Position: 523
Cell Line: 147T
Transfection Method: Calcium Phosohate
Incubation Time (Hours): 24
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: BLOCK-iT Invitrogen
PubMed:19276448
Target Object (mRNA,Protein,etc): mRNA
Silencing Efficacy :Low
Structure:
siRNA sequence matching with Human Papillomavirus [HPV] reference genome:
Target mRNA1:E6/E7
mRNA1 % inhibition:Low
mRNA1 Detection Method:Quantitative RT-PCR

.
.
.
.
.
.
.
.
.
.
.

.

.

.