siRNA Id: | virsi1711 |
Sense Sequence: | ccaccaacgucacacaaugu |
Length: | 20 |
GC Content (%): | 50 |
Virus Name: | Human Papillomavirus [HPV] |
Family of Virus: | Papillomaviridae |
Virus Strain: | HPV18 |
Target Gene: | E7 |
Genbank Accession: | NC_001357 |
Starting Position | 750 |
Ending Position: | 769 |
Cell Line: | HeLa |
Concentration: | 100 nM |
Transfection Method: | Lipofectamine |
Incubation Time (Hours): | 72 |
siRNA Expression Method: | Chemically Synthesized |
PubMed: | 17636212 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | High |
Structure: | ![]() |
siRNA sequence matching with Human Papillomavirus [HPV] reference genome: | ![]() |
Protein1: | E7 |
Protein1 % inhibition: | High |
Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.