| siRNA Id: | virsi1711 |
| Sense Sequence: | ccaccaacgucacacaaugu |
| Length: | 20 |
| GC Content (%): | 50 |
| Virus Name: | Human Papillomavirus [HPV] |
| Family of Virus: | Papillomaviridae |
| Virus Strain: | HPV18 |
| Target Gene: | E7 |
| Genbank Accession: | NC_001357 |
| Starting Position | 750 |
| Ending Position: | 769 |
| Cell Line: | HeLa |
| Concentration: | 100 nM |
| Transfection Method: | Lipofectamine |
| Incubation Time (Hours): | 72 |
| siRNA Expression Method: | Chemically Synthesized |
| PubMed: | 17636212 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | High |
| Structure: |  |
| siRNA sequence matching with Human Papillomavirus [HPV] reference genome: |  |
| Protein1: | E7 |
| Protein1 % inhibition: | High |
| Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.