siRNA Id: | virsi1715 |
Sense Sequence: | aggaggaugaaauagauggu |
Length: | 20 |
GC Content (%): | 40 |
Virus Name: | Human Papillomavirus [HPV] |
Family of Virus: | Papillomaviridae |
Virus Strain: | HPV16 |
Target Gene: | E7 |
Genbank Accession: | NC_001526 |
Starting Position | 662 |
Ending Position: | 681 |
Cell Line: | CaSki |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 24 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | BLOCK-iT Invitrogen |
PubMed: | 19174559 |
Target Object (mRNA,Protein,etc): | RNA |
Silencing Efficacy : | 100 |
Structure: | ![]() |
siRNA sequence matching with Human Papillomavirus [HPV] reference genome: | ![]() |
Target mRNA1: | E7 |
mRNA1 % inhibition: | High |
mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.