virsi1752 details

siRNA Id:virsi1752
Sense Sequence: cuuugcuuuucgggauuuaug
Length: 21
GC Content (%):38
Virus Name:Human Papillomavirus [HPV]
Family of Virus:Papillomaviridae
Virus Strain:HPV16
Target Gene:E6
Genbank Accession: NC_001526
Starting Position 235
Ending Position: 255
Cell Line: SiHa
Concentration: 50 nM
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 48
siRNA design algorithm used: siDirect Software
PubMed:18157144
Target Object (mRNA,Protein,etc): mRNA
Silencing Efficacy :36
Structure:
siRNA sequence matching with Human Papillomavirus [HPV] reference genome:
Target mRNA1:E6
mRNA1 % inhibition:36
mRNA1 Detection Method:RT-PCR

.
.
.
.
.
.
.
.
.
.
.

.

.

.