siRNA Id: | virsi1759 |
Sense Sequence: | gcccauuacaauauuguaacc |
Length: | 21 |
GC Content (%): | 38 |
Virus Name: | Human Papillomavirus [HPV] |
Family of Virus: | Papillomaviridae |
Virus Strain: | HPV16 |
Target Gene: | E7 |
Genbank Accession: | NC_001526 |
Starting Position | 709 |
Ending Position: | 729 |
Cell Line: | SiHa |
Concentration: | 50 nM |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 48 |
siRNA design algorithm used: | siDirect Software |
PubMed: | 18157144 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 74 |
Structure: | |
siRNA sequence matching with Human Papillomavirus [HPV] reference genome: | |
Target mRNA1: | E6 |
mRNA1 % inhibition: | 74 |
mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.