| siRNA Id: | virsi1759 |
| Sense Sequence: | gcccauuacaauauuguaacc |
| Length: | 21 |
| GC Content (%): | 38 |
| Virus Name: | Human Papillomavirus [HPV] |
| Family of Virus: | Papillomaviridae |
| Virus Strain: | HPV16 |
| Target Gene: | E7 |
| Genbank Accession: | NC_001526 |
| Starting Position | 709 |
| Ending Position: | 729 |
| Cell Line: | SiHa |
| Concentration: | 50 nM |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 48 |
| siRNA design algorithm used: | siDirect Software |
| PubMed: | 18157144 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 74 |
| Structure: |  |
| siRNA sequence matching with Human Papillomavirus [HPV] reference genome: |  |
| Target mRNA1: | E6 |
| mRNA1 % inhibition: | 74 |
| mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.