siRNA Id: | virsi1761 |
Sense Sequence: | caccuacauugcaugaauaua |
Length: | 21 |
GC Content (%): | 33 |
Virus Name: | Human Papillomavirus [HPV] |
Family of Virus: | Papillomaviridae |
Virus Strain: | HPV16 |
Target Gene: | E7 |
Genbank Accession: | NC_001526 |
Starting Position | 575 |
Ending Position: | 595 |
Cell Line: | SiHa |
Concentration: | 50 nM |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 48 |
siRNA design algorithm used: | siDirect Software |
PubMed: | 18157144 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 71 |
Structure: | ![]() |
siRNA sequence matching with Human Papillomavirus [HPV] reference genome: | ![]() |
Target mRNA1: | E7 |
mRNA1 % inhibition: | 71 |
mRNA1 Detection Method: | RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.