| siRNA Id: | virsi1769 |
| Sense Sequence: | guaaccgaaaucgguugaacc |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | Human Papillomavirus [HPV] |
| Family of Virus: | Papillomaviridae |
| Virus Strain: | HPV16 |
| Target Gene: | P97 of E6/E7 |
| Genbank Accession: | NC_001526 |
| Starting Position | 32 |
| Ending Position: | 52 |
| Cell Line: | SiHa |
| Concentration: | 40 μM |
| Transfection Method: | Codebreaker |
| Incubation Time (Hours): | 48 |
| siRNA design algorithm used: | Promega |
| PubMed: | 19826423 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 50 |
| Structure: |  |
| siRNA sequence matching with Human Papillomavirus [HPV] reference genome: |  |
| RNA Detection method: | RT-PCR |
| Protein1: | E6 |
| Protein1 % inhibition: | 37.1 |
| Protein1 Detection Method: | Immunocytochemistry |
| Protein2: | E7 |
| Protein2 % inhibition : | 34.2 |
| Protein2 Detection Method: | Immunocytochemistry |
.
.
.
.
.
.
.
.
.
.
.
.
.