siRNA Id: | virsi1769 |
Sense Sequence: | guaaccgaaaucgguugaacc |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | Human Papillomavirus [HPV] |
Family of Virus: | Papillomaviridae |
Virus Strain: | HPV16 |
Target Gene: | P97 of E6/E7 |
Genbank Accession: | NC_001526 |
Starting Position | 32 |
Ending Position: | 52 |
Cell Line: | SiHa |
Concentration: | 40 μM |
Transfection Method: | Codebreaker |
Incubation Time (Hours): | 48 |
siRNA design algorithm used: | Promega |
PubMed: | 19826423 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 50 |
Structure: | |
siRNA sequence matching with Human Papillomavirus [HPV] reference genome: | |
RNA Detection method: | RT-PCR |
Protein1: | E6 |
Protein1 % inhibition: | 37.1 |
Protein1 Detection Method: | Immunocytochemistry |
Protein2: | E7 |
Protein2 % inhibition : | 34.2 |
Protein2 Detection Method: | Immunocytochemistry |
.
.
.
.
.
.
.
.
.
.
.
.
.