siRNA Id: | virsi1775 |
Sense Sequence: | agaaauuggcucgaauuguuuuaauauua |
Length: | 29 |
GC Content (%): | 24 |
Virus Name: | Enterovirus [EV] |
Family of Virus: | Picornaviridae |
Virus Strain: | EV71 (5865/ SIN/00009) |
Target Gene: | 3D Pol |
Genbank Accession: | AF316321 |
Starting Position | 7305 |
Ending Position: | 7333 |
Cell Line: | RD |
Concentration: | 10 nM |
Transfection Method: | Oligofectamine |
Incubation Time (Hours): | 24 |
siRNA Expression Method: | Expressed |
siRNA design algorithm used: | Promega |
PubMed: | 17712333 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 0 |
Structure: | |
siRNA sequence matching with Enterovirus [EV] reference genome: | |
Target mRNA1: | EV 71 Transcripts |
mRNA1 % inhibition: | 0 |
mRNA1 Detection Method: | Real Time RT-PCR |
Protein1: | VP1 |
Protein1 % inhibition: | 0 |
Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.