virsi1775 details

siRNA Id:virsi1775
Sense Sequence: agaaauuggcucgaauuguuuuaauauua
Length: 29
GC Content (%):24
Virus Name:Enterovirus [EV]
Family of Virus:Picornaviridae
Virus Strain:EV71 (5865/ SIN/00009)
Target Gene:3D Pol
Genbank Accession: AF316321
Starting Position 7305
Ending Position: 7333
Cell Line: RD
Concentration: 10 nM
Transfection Method: Oligofectamine
Incubation Time (Hours): 24
siRNA Expression Method: Expressed
siRNA design algorithm used: Promega
PubMed:17712333
Target Object (mRNA,Protein,etc): mRNA
Silencing Efficacy :0
Structure:
siRNA sequence matching with Enterovirus [EV] reference genome:
Target mRNA1:EV 71 Transcripts
mRNA1 % inhibition:0
mRNA1 Detection Method:Real Time RT-PCR
Protein1:VP1
Protein1 % inhibition:0
Protein1 Detection Method:Western Blotting

.
.
.
.
.
.
.
.
.
.
.

.

.

.