| siRNA Id: | virsi1776 |
| Sense Sequence: | gcgcaauuaacuauuggcaacucca |
| Length: | 25 |
| GC Content (%): | 44 |
| Virus Name: | Enterovirus [EV] |
| Family of Virus: | Picornaviridae |
| Virus Strain: | EV71 Strain Shzh-98 |
| Target Gene: | VP2 |
| Genbank Accession: | AF302996 |
| Starting Position | 990 |
| Ending Position: | 1014 |
| Cell Line: | RD |
| Concentration: | 40 pM |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | BLOCK-iT Invitrogen |
| PubMed: | 19490979 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 91 |
| Structure: |  |
| siRNA sequence matching with Enterovirus [EV] reference genome: |  |
| Target mRNA1: | VP2 |
| mRNA1 % inhibition: | 91.2 |
| mRNA1 Detection Method: | Real Time RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.