siRNA Id: | virsi1778 |
Sense Sequence: | caugucaccugcgagugcuuaucaa |
Length: | 25 |
GC Content (%): | 48 |
Virus Name: | Enterovirus [EV] |
Family of Virus: | Picornaviridae |
Virus Strain: | EV71 Strain Shzh-98 |
Target Gene: | VP1 |
Genbank Accession: | AF302996 |
Starting Position | 3020 |
Ending Position: | 3044 |
Cell Line: | RD |
Concentration: | 40 pM |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 48 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | BLOCK-iT Invitrogen |
PubMed: | 19490979 |
Target Object (mRNA,Protein,etc): | RNA |
Silencing Efficacy : | 79 |
Structure: | |
siRNA sequence matching with Enterovirus [EV] reference genome: | |
Target mRNA1: | VP1 |
mRNA1 % inhibition: | 79.4 |
mRNA1 Detection Method: | Real Time RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.