| siRNA Id: | virsi1781 |
| Sense Sequence: | agaaauuggcucgaauuguuuuaauauua |
| Length: | 29 |
| GC Content (%): | 24 |
| Virus Name: | Enterovirus [EV] |
| Family of Virus: | Picornaviridae |
| Virus Strain: | EV71 Strain 5865/SIN/00009 |
| Target Gene: | 3D Pol |
| Genbank Accession: | AF316321 |
| Starting Position | 7305 |
| Ending Position: | 7333 |
| Cell Line: | RD |
| Concentration: | 10 nM |
| Transfection Method: | Lipofectamine 2000CD |
| Incubation Time (Hours): | 48 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Elbashir |
| PubMed: | 17316836 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 89 |
| Structure: |  |
| siRNA sequence matching with Enterovirus [EV] reference genome: |  |
| Protein1: | VP1 |
| Protein1 % inhibition: | 91 |
| Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.