| siRNA Id: | virsi1844 |
| Sense Sequence: | aaggugugagcauggugucau |
| Length: | 21 |
| GC Content (%): | 48 |
| Virus Name: | Human Coxsackievirus [CV] |
| Family of Virus: | Picornaviridae |
| Virus Strain: | B3 |
| Target Gene: | 2A |
| Genbank Accession: | M33854 |
| Starting Position | 3636 |
| Ending Position: | 3656 |
| Cell Line: | HeLa |
| Concentration: | 300 pM |
| Transfection Method: | Oligofectamine |
| Incubation Time (Hours): | 12 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Ambion |
| PubMed: | 15795330 |
| Target Object (mRNA,Protein,etc): | Protein |
| Silencing Efficacy : | 75 |
| Structure: |  |
| siRNA sequence matching with Human Coxsackievirus [CV] reference genome: |  |
| Protein1: | VP1 |
| Protein1 % inhibition: | 75 |
| Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.