siRNA Id: | virsi1844 |
Sense Sequence: | aaggugugagcauggugucau |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | Human Coxsackievirus [CV] |
Family of Virus: | Picornaviridae |
Virus Strain: | B3 |
Target Gene: | 2A |
Genbank Accession: | M33854 |
Starting Position | 3636 |
Ending Position: | 3656 |
Cell Line: | HeLa |
Concentration: | 300 pM |
Transfection Method: | Oligofectamine |
Incubation Time (Hours): | 12 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Ambion |
PubMed: | 15795330 |
Target Object (mRNA,Protein,etc): | Protein |
Silencing Efficacy : | 75 |
Structure: | ![]() |
siRNA sequence matching with Human Coxsackievirus [CV] reference genome: | ![]() |
Protein1: | VP1 |
Protein1 % inhibition: | 75 |
Protein1 Detection Method: | Western Blotting |
.
.
.
.
.
.
.
.
.
.
.
.
.