siRNA Id: | virsi1845 |
Sense Sequence: | aggcaagcuguccuucuuuga |
Length: | 21 |
GC Content (%): | 48 |
Virus Name: | Epstein-Barr Virus [EBV] |
Family of Virus: | Herpesviridae |
Virus Strain: | B95-8 |
Target Gene: | PR |
Genbank Accession: | NC_009334 |
Starting Position | 136857 |
Ending Position: | 136877 |
Cell Line: | 293/EBV-GFP |
Concentration: | 100 nM |
Transfection Method: | Jetsi-ENDO |
Incubation Time (Hours): | 72 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | QIAGEN |
PubMed: | 19704168 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 48 |
Structure: | |
siRNA sequence matching with Epstein-Barr Virus [EBV] reference genome: | |
Target mRNA1: | PR |
mRNA1 % inhibition: | 48 |
mRNA1 Detection Method: | Real-Time RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.