| siRNA Id: | virsi1846 |
| Sense Sequence: | aagcacuuuagugaccuggaa |
| Length: | 21 |
| GC Content (%): | 43 |
| Virus Name: | Epstein-Barr Virus [EBV] |
| Family of Virus: | Herpesviridae |
| Virus Strain: | B95-8 |
| Target Gene: | PR |
| Genbank Accession: | NC_009334 |
| Starting Position | 136954 |
| Ending Position: | 136974 |
| Cell Line: | 293/EBV-GFP |
| Concentration: | 100 nM |
| Transfection Method: | Jetsi-ENDO |
| Incubation Time (Hours): | 72 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | QIAGEN |
| PubMed: | 19704168 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 64 |
| Structure: |  |
| siRNA sequence matching with Epstein-Barr Virus [EBV] reference genome: |  |
| Target mRNA1: | PR |
| mRNA1 % inhibition: | 64 |
| mRNA1 Detection Method: | Real-Time RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.