virsi1848 details

siRNA Id:virsi1848
Sense Sequence: aaggccaucgaugcuggauuu
Length: 21
GC Content (%):48
Virus Name:Epstein-Barr Virus [EBV]
Family of Virus:Herpesviridae
Virus Strain:B95-8
Target Gene:PR
Genbank Accession: NC_009334
Starting Position 137074
Ending Position: 137094
Cell Line: 293/EBV-GFP
Concentration: 100 nM
Transfection Method: Jetsi-ENDO
Incubation Time (Hours): 72
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: QIAGEN
PubMed:19704168
Target Object (mRNA,Protein,etc): mRNA
Silencing Efficacy :54
Structure:
siRNA sequence matching with Epstein-Barr Virus [EBV] reference genome:
Target mRNA1:PR
mRNA1 % inhibition:54
mRNA1 Detection Method:Real-Time RT-PCR

.
.
.
.
.
.
.
.
.
.
.

.

.

.