| siRNA Id: | virsi1864 |
| Sense Sequence: | gugauaaccauggacgaggacggggaa |
| Length: | 27 |
| GC Content (%): | 56 |
| Virus Name: | Epstein-Barr Virus [EBV] |
| Family of Virus: | Herpesviridae |
| Virus Strain: | B95-8 |
| Target Gene: | EBNA1 |
| Genbank Accession: | V01555 |
| Starting Position | 108056 |
| Ending Position: | 108082 |
| Cell Line: | SNU-719 |
| Concentration: | 30 nM |
| Transfection Method: | Lipofectamine 2000 |
| Incubation Time (Hours): | 72 |
| siRNA Expression Method: | Chemically Synthesized |
| siRNA design algorithm used: | Genolution Pharmaceuticals |
| PubMed: | 19471888 |
| Target Object (mRNA,Protein,etc): | mRNA |
| Silencing Efficacy : | 28 |
| Structure: | ![]() |
| siRNA sequence matching with Epstein-Barr Virus [EBV] reference genome: | ![]() |
| Target mRNA1: | EBNA1 |
| mRNA1 % inhibition: | 28.3 |
| mRNA1 Detection Method: | Real-Time RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.

