siRNA Id: | virsi1868 |
Sense Sequence: | cugcaaagggacccacgguggaacagg |
Length: | 27 |
GC Content (%): | 63 |
Virus Name: | Epstein-Barr Virus [EBV] |
Family of Virus: | Herpesviridae |
Virus Strain: | B95-8 |
Target Gene: | EBNA1 |
Genbank Accession: | V01555 |
Starting Position | 108192 |
Ending Position: | 108218 |
Cell Line: | SNU-719 |
Concentration: | 30 nM |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 72 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Genolution Pharmaceuticals |
PubMed: | 19471888 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 0 |
Structure: | |
siRNA sequence matching with Epstein-Barr Virus [EBV] reference genome: | |
Target mRNA1: | EBNA1 |
mRNA1 % inhibition: | 0 |
mRNA1 Detection Method: | Real-Time RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.