virsi1870 details

siRNA Id:virsi1870
Sense Sequence: ccgggagcgauagagcagggccccg
Length: 25
GC Content (%):76
Virus Name:Epstein-Barr Virus [EBV]
Family of Virus:Herpesviridae
Virus Strain:B95-8
Target Gene:EBNA1
Genbank Accession: V01555
Starting Position 109240
Ending Position: 109264
Cell Line: SNU-719
Concentration: 30 nM
Transfection Method: Lipofectamine 2000
Incubation Time (Hours): 72
siRNA Expression Method: Chemically Synthesized
siRNA design algorithm used: Genolution Pharmaceuticals
PubMed:19471888
Target Object (mRNA,Protein,etc): mRNA
Silencing Efficacy :13
Structure:
siRNA sequence matching with Epstein-Barr Virus [EBV] reference genome:
Target mRNA1:EBNA1
mRNA1 % inhibition:12.9
mRNA1 Detection Method:Real-Time RT-PCR

.
.
.
.
.
.
.
.
.
.
.

.

.

.