siRNA Id: | virsi1880 |
Sense Sequence: | gauggaguagauuugccucccuggu |
Length: | 25 |
GC Content (%): | 52 |
Virus Name: | Epstein-Barr Virus [EBV] |
Family of Virus: | Herpesviridae |
Virus Strain: | gD1 |
Target Gene: | EBNA1 |
Genbank Accession: | AY961628 |
Starting Position | 97383 |
Ending Position: | 97407 |
Cell Line: | HeLa |
Concentration: | 10 nM |
Transfection Method: | Lipofectamine 2000 |
Incubation Time (Hours): | 72 |
siRNA Expression Method: | Chemically Synthesized |
siRNA design algorithm used: | Genolution Pharmaceuticals |
PubMed: | 19471888 |
Target Object (mRNA,Protein,etc): | mRNA |
Silencing Efficacy : | 22 |
Structure: | |
siRNA sequence matching with Epstein-Barr Virus [EBV] reference genome: | |
Target mRNA1: | EBNA1 |
mRNA1 % inhibition: | 21.5 |
mRNA1 Detection Method: | Real-Time RT-PCR |
.
.
.
.
.
.
.
.
.
.
.
.
.